 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Apr 01, 2024 |
| Title |
A. calliptera, testes, rep2 [smallRNA-seq] |
| Sample type |
SRA |
| |
|
| Source name |
Testes
|
| Organism |
Astatotilapia calliptera |
| Characteristics |
tissue: Testes
genotype: wild-type
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Tissue pieces were transferred to BeadBug tubes prefilled with 0.5 mm Zirconium beads (Merck, #Z763772) and 500-600 µl of TRIzol (Life Technologies, #15596026) was added to the tubes and mixed vigorously. Afterwards, we conducted the homogenisation using a BeadBug microtube homogeniser (Sigma, #Z764140) at approximately 4oC (in cold room). Each sample was homogenised with five BeadBug runs at maximum speed (4000 rpm) for 60 seconds each. Supernatant was then removed into a clean 1.5 mL tube. Centrifuged the lysates again, this time at maximum speed (approximately 21,000 G) for 5 minutes at 4oC. Transferred supernatant into a clean tube without disturbing the pellet and tissue debris. Mixed supernatant thoroughly 1:1 with 100% ethanol, pipetted the mix into a column provided in the Direct-zol RNA Miniprep Plus kit (Zymo Research, #R2072) and followed manufacturer’s instructions, using the recommended in-column DNase I treatment.
Samples were processed according to the NEXTFLEX® Small RNA-Seq Kit v4 with UDIs (PerkinElmer, #NOVA-5132-32) with a 1 µg starting input and 12 cycles of PCR. Samples were then pooled in equimolar amounts according to the TapeStation results and sequenced on a Novaseq 6000 system (PE50 on one lane of an SP Flowcell).
|
| |
|
| Library strategy |
ncRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina NovaSeq 6000 |
| |
|
| Description |
Aca_tes_n_rep2
|
| Data processing |
The data resides within R1 so R2 was discarded. CutAdapt v1.15 (Martin, 2011) was used to remove adapters and reads shorter than 18 nucleotides with options -a TGGAATTCTCGGGTGCCAAGG minimum-length 18 -o.
We selected small RNAs in the piRNA size range, between 24 and 35 nucleotides long, for further analysis. We have done this size selection using CutAdapt v1.15 (Martin, 2011) with options ‑‑minimum-length 24 --maximum-length 35.
We mapped the 24-35 nucleotide long reads to the genome using STAR v2.5.4b (Dobin et al., 2013), with options --outTmpDir --genomeDir --readFilesIn --readFilesCommand zcat outMultimapperOrder Random --outFilterMultimapNmax 100 outFilterMismatchNmax 2 --alignIntronMax 1 --outSAMtype BAM SortedByCoordinate --outFilterType BySJout --winAnchorMultimapNmax 100 --alignEndsType EndToEnd scoreDelOpen -10000 --scoreInsOpen -10000 --outSAMmultNmax 1 outFileNamePrefix. Reads from Lake Malawi cichlid species (A. calliptera, M. zebra, T. sp. "mauve") were all mapped to the A. calliptera genome fAstCal1.2. A. burtoni, P. nyererei, and O. niloticus reads were mapped to their genomes: AstBur1.0, PunNye1.0, and O_niloticus_UMD_NMBU respectively. All these genomes are available at Ensembl.
To quantify piRNA counts mapping to TEs, we used featureCounts v1.6.0 (Liao et al., 2014) with options -a -o -t exon -M. The 24-35 nucleotide long BAM file was used as input. For Lake Malawi cichlids, featureCounts analysis was performed twice, using A. calliptera default and curated TE annotations. DESeq2 (Love et al., 2014) and custom scripts were used to calculate normalized counts, generate plots and conduct statistical tests on an R framework (R Core Team, 2021).
Assembly: fAstCal1.2; AstBur1.0; PunNye1.0; O_niloticus_UMD_NMBU
Supplementary files format and content: Abur_sRNA_NormTEcounts_GEO.txt. Tab-delimited file includes DESeq2 normalized counts for piRNAs mapping to TEs in each A. burtoni sample.
Supplementary files format and content: Malawi_sRNA_NormTEcounts_CuratedAnnotation_GEO.txt. Tab-delimited file includes DESeq2 normalized counts for piRNAs mapping to TEs in each Lake Malawi cichlid sample. Using a curated TE annotation.
Supplementary files format and content: Malawi_sRNA_NormTEcounts_GEO.txt. Tab-delimited file includes DESeq2 normalized counts for piRNAs mapping to TEs in each Lake Malawi cichlid sample.
Supplementary files format and content: Onil_sRNA_NormTEcounts_GEO.txt. Tab-delimited file includes DESeq2 normalized counts for piRNAs mapping to TEs in each O. niloticus sample.
Supplementary files format and content: Pnye_sRNA_NormTEcounts_GEO.txt. Tab-delimited file includes DESeq2 normalized counts for piRNAs mapping to TEs in each P. nyererei sample.
|
| |
|
| Submission date |
Jan 09, 2024 |
| Last update date |
Apr 01, 2024 |
| Contact name |
Miguel Vasconcelos Almeida |
| E-mail(s) |
miguelddv.almeida@gmail.com, mdd34@cam.ac.uk
|
| Organization name |
University of Cambridge
|
| Department |
Department of Biochemistry
|
| Street address |
Tennis Court Road
|
| City |
Cambridge |
| ZIP/Postal code |
CB2 1GA |
| Country |
United Kingdom |
| |
|
| Platform ID |
GPL30104 |
| Series (1) |
| GSE252804 |
Dynamic co-evolution of transposable elements and the piRNA pathway in East African cichlid fishes [smallRNA-seq] |
|
| Relations |
| BioSample |
SAMN39313620 |
| SRA |
SRX23139527 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
|
|
|
|
 |
