|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Mar 01, 2022 |
Title |
DSP-1010910372664-E-E03 |
Sample type |
SRA |
|
|
Source name |
FxF E13.5 embryo
|
Organism |
Mus musculus |
Characteristics |
slide name: AEL026 S1 G8S4 FxF mouse embryo E13 NBF full ROIs scan name: AEL026 S1 G8S4 FxF mouse embryo E13 NBF full ROIs panel: (v1.0) Mouse NGS Whole Transcriptome Atlas RNA roi: 050 area: 6777.21 tissue: Metanephros tissue_substructure: Nephron tissue_region: Cortex molecule: other: mRNA ISH
|
Extracted molecule |
total RNA |
Extraction protocol |
Samples were incubated with the mouse Whole Transcriptome Atlas RNA-ISH probes which were conjugated with a UV-photocleavable linker following standard ISH protocols, along with fluorescently labeled antibodies for visualization of morphological structures. Regions of interest within the tissue were illuminated with UV light and oligo barcodes were physically aspirated from the tissue and collected into microtiter plates by the GeoMx® Digital Spatial Profiler (DSP) platform. For more information about DSP protocols please see Merritt et al. Nature Biotech 2020 (doi: 10.1038/s41598-020-63539-x) Each collection of oligo tags from one well (representing an AOI from the tissue section) was indexed with i7xi5 unique dual indexes using GeoMx SeqCode primers with 18 cycles of PCR. After PCR, indexed AOIs were pooled and purified in two rounds of AMPure XP PCR purification using 1.2x bead:sample ratio.
|
|
|
Library strategy |
OTHER |
Library source |
transcriptomic |
Library selection |
other |
Instrument model |
NextSeq 2000 |
|
|
Data processing |
Library strategy: GeoMx Seq GeoMx NGS Pipeline v2.3.3.10 with the following parameters: quality-trim-score = 20, 2color-trimming = True, adapter1 = AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC, adapter2 = AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT, adapter-trim-match-length = 10, adapter-trim-max-mismatch = 3, barcode-max-mismatch = 1, stitching-max-mismatch = 2 Genome_build: NA Supplementary_files_format_and_content: Digital Count Conversion (DCC) files: format outputted from GeoMx NGS Pipeline, contains software versions, scan attributes, GeoMx NGS pipeline parameters and output metrics, Q30 scores, and list of deduplicated counts per RTS_ID (probe barcode) Supplementary_files_format_and_content: RawCounts: xlsx file outputted from the GeoMx DSPDA analysis software containing sample annotations, probe information, and raw probe count matrix for each probe and sample Supplementary_files_format_and_content: CollapsedTargetCounts: xlsx file outputted from the GeoMx DSPDA analysis software containing sample annotations, processing information, and target-level count matrix for each gene target and sample Supplementary_files_format_and_content: NormalizedTargetCounts: xlsx file outputted from the GeoMx DSPDA analysis software containing sample annotations, processing information, and Q3 normalized target-level count matrix for each gene target and sample
|
|
|
Submission date |
Oct 26, 2021 |
Last update date |
Mar 02, 2022 |
Contact name |
Stephanie Zimmerman |
E-mail(s) |
stzimmerman@nanostring.com
|
Organization name |
NanoString Technologies
|
Street address |
530 Fairview Ave N
|
City |
Seattle |
State/province |
WA |
ZIP/Postal code |
98109 |
Country |
USA |
|
|
Platform ID |
GPL30172 |
Series (2) |
GSE186594 |
Spatially resolved whole transcriptome profiling in human and mouse tissue using Digital Spatial Profiling [E13.5 mouse embryo] |
GSE190089 |
Spatially resolved whole transcriptome profiling in human and mouse tissue using Digital Spatial Profiling |
|
Relations |
BioSample |
SAMN22569863 |
SRA |
SRX12777347 |
Supplementary file |
Size |
Download |
File type/resource |
GSM5657058_DSP-1010910372664-E-E03.dcc.gz |
60.4 Kb |
(ftp)(http) |
DCC |
SRA Run Selector |
Raw data are available in SRA |
Processed data provided as supplementary file |
Processed data are available on Series record |
|
|
|
|
|