|
| Status |
Public on Oct 18, 2020 |
| Title |
Analysis of the response to PD1 therapy in B16R2L mouse melanoma tumors knockdown for Mdk. |
| Organism |
Mus musculus |
| Experiment type |
Expression profiling by high throughput sequencing
|
| Summary |
Gene expression analysis in tumors generated by B16R2L cells injected in C57BL/6J mice and treated with anti-PD1 (clone RMP1-14, 10 gr/Kg) or the corresponding IgG2a control.
|
| |
|
| Overall design |
5x105 B16R2L mouse melanoma cells control (shCtrl; Non-Target shRNA (CAACAAGATGAAGAGCACCAA)) or knockdown for mouse Mdk (shMdk-5 (NM_010784.4-734s1c1). When the tumor reached 100 mm3 the anaimals injected for each of the cell types were subdivided in 2 groups to be treated twice per week for 2 weeks with anti-PD1 (clone RMP1-14, 10 gr/Kg) or the corresponding IgG2a control. Quadriplicted tumors were excised and total RNA was extracted. 500ng of total RNA samples were used. Each condition was analyzed in quadruplicates. Sequencing libraries were prepared with the "QuantSeq 3‘ mRNA-Seq Library Prep Kit (FWD) for Illumina" (Lexogen, Cat.No. 015) by following manufacturer instructions.
|
| |
|
| Contributor(s) |
Cerezo-Wallis D, Olmeda D, Graña-Castro O, Soengas MS |
| Citation(s) |
33077955 |
| Submission date |
May 12, 2020 |
| Last update date |
Jan 18, 2021 |
| Contact name |
David Olmeda |
| E-mail(s) |
dolmeda@cnio.es
|
| Organization name |
CNIO
|
| Department |
Molecular Oncology
|
| Lab |
Melanoma
|
| Street address |
Melchor Fernandez Almagro 3
|
| City |
Madrid |
| State/province |
Madrid |
| ZIP/Postal code |
28050 |
| Country |
Spain |
| |
|
| Platforms (1) |
|
| Samples (16)
|
|
| Relations |
| BioProject |
PRJNA631978 |
| SRA |
SRP261307 |
Less...
More...