U.S. flag

An official website of the United States government

NCBI Bookshelf. A service of the National Library of Medicine, National Institutes of Health.

Adam MP, Feldman J, Mirzaa GM, et al., editors. GeneReviews® [Internet]. Seattle (WA): University of Washington, Seattle; 1993-2024.

Cover of GeneReviews®

GeneReviews® [Internet].

Show details

Resources for Genetics Professionals — Genetic Disorders Caused by Nucleotide Repeat Expansions and Contractions

, MD and , PhD.

Author Information and Affiliations

Initial Posting: ; Last Revision: October 20, 2022.

Estimated reading time: 6 minutes

Nucleotide Repeat Expansions and Contractions

A nucleotide repeat is a sequence of nucleotides repeated a number of times in tandem; nucleotide repeats can occur within or near a gene. The size of nucleotide repeats varies: smaller numbers of repeats are common and not associated with phenotypic abnormalities; abnormally large numbers of repeats may be associated with phenotypic abnormalities and are classified as (in increasing order of size): mutable normal alleles, premutations, reduced-penetrance alleles, and full-penetrance alleles.

Molecular genetic testing used to sequence nucleotide repeats is more difficult than sequencing nonrepetitive regions of the exome because:

  • Many of the known nucleotide repeats contain a higher GC content, which is difficult to amplify by PCR; and
  • Repetitive regions do not align uniquely; thus, the length of the repeated sequence cannot be determined.

Specific assays are required to analyze each nucleotide repeat of interest:

  • DNA containing smaller nucleotide repeats can be amplified by PCR. The amplified segments of DNA are then separated by gel or capillary electrophoresis to determine repeat length.
  • Highly expanded nucleotide repeats may not be detected by PCR-based assays due to difficulty in aligning the sequence to a unique genomic position. Additional testing (e.g., Southern blot analysis or triplet repeat primed PCR) may be required to determine the length of highly expanded nucleotide repeats.

Table.

Genetic Disorders Caused by Nucleotide Repeat Expansions and Contractions

GeneDisorder 1MOI% of Pathogenic Variants 1Nucleotide Repeat
(Amino Acid)		Repeat LocationNormal Repeat Number 2Full-Penetrance Pathogenic Repeat Number
AFF2 Fragile X syndrome, FRAXE type (OMIM 309548)XLMost commonCCG5' UTR4-39>200
AR Spinal and bulbar muscular atrophy XL100%CAG (Gln)Exon 1≤34≥38
ARX Early-infantile epileptic encephalopathy (OMIM 308350);
Partington syndrome (OMIM 309510)		XLMost commonGCG (Ala)Exon 2
aa 110-115		10-1617-27
GCG (Ala)Exon 2
aa 144-155		1220
ATN1 DRPLA AD100%CAG (Gln)Exon 56-35≥48
ATXN1 Spinocerebellar ataxia type 1 AD100%CAG (Gln)Exon 86-35≥39
ATXN2 Spinocerebellar ataxia type 2 AD100%CAG (Gln)Exon 1≤31>34
ATXN3 Spinocerebellar ataxia type 3 AD100%CAG (Gln)Exon 812-44~60-87
ATXN7 Spinocerebellar ataxia type 7 AD100%CAG (Gln)Exon 17-2737-460
ATXN8 Spinocerebellar ataxia type 8 AD100%CAG (Gln)Exon 1~80Unknown
ATXN8OS CTG3' UTR15-50
CTA/CTG		See footnote 3.
ATXN10 Spinocerebellar ataxia type 10 AD100%ATTCTIntron 910-32≥800
BEAN1 Spinocerebellar ataxia type 31 (OMIM 117210)AD100%TGGAAIntron 602.5- to 3.8-kb insertion
C9orf72 C9orf72-related amyotrophic lateral sclerosis and frontotemporal dementia AD100%GGGGCCPromotor or intron 12-24>60
CACNA1A Spinocerebellar ataxia type 6 >99%CAG (Gln)Exon 7≤1820-33
CNBP Myotonic dystrophy type 2 100%CCTGIntron 1≤26≥75
COMP Multiple epiphyseal dysplasia ADRare 4GAC (Asp)Exon 1356
Pseudoachondroplasia ~33% 42-4 or 7
CSTB Progressive myoclonic epilepsy type 1 AR~90%CCCCGCCCCGCGPromoter2-3≥30
DAB1 Spinocerebellar ataxia type 37 AD100%ATTTC5' UTR intron031-75
DIP2B Mental retardation, FRA12A type (OMIM 136630)AD100%CGGPromoter6-23>350
DMD Duchenne muscular dystrophy XL1 family 5GAAIntron 6211-3359-82
DMPK Myotonic dystrophy type 1 AD100%CTG3' UTR5-34>50
EIF4A3 Pierre Robin sequence with cleft mandible and limb anomalies (OMIM 268305)AR100%Complex 65' UTR5-12≥15
FMR1 FMR1-related disorders XL>99%CGG5' UTR5-44>200
FOXL2 Blepharophimosis, ptosis, and epicanthus inversus AD31%GCN (Ala)Exon 11415-24
FXN Friedreich ataxia AR~98%GAAIntron 15-33≥66
GIPC1 Oculopharyngodistal myopathy 2 (OMIM 618940)AD100%GGC5' UTR12-3273-164
GLS Glutaminase deficiency with impaired intellectual development and progressive ataxia (OMIM 618412)AR3 individualsGCA5' UTR5-38680-1500
HOXA13 Hand-foot-genital syndrome AD50%-60%GCN (Ala)Exon 1
aa 38		1422
Exon 1
aa 73		1218
Exon 1
aa 116		8, 12, or 1822-32
HOXD13 Syndactyly type V (OMIM 186300)AD3 individualsGCN (Ala)Exon 1158-11 or ≥22
HTT Huntington disease AD100%CAG (Gln)Exon 1≤26≥40
JPH3 Huntington disease-like 2 AD~100%CTG (Ala)Exon 2A6-28≥40
LRP12 Oculopharyngodistal myopathy (OMIM 164310) 7ADUnknownCGG/CGT5' UTR13-45Unknown
MARCHF6 Familial adult myoclonic epilepsy 3 (OMIM 613608)AD100%TTTTA/TTTCAIntron 19-20 8791-1035
MUC1 Autosomal dominant tubulointerstitial kidney disease, MUC1-related AD~95%C 9Exon 278
NOP56 Spinocerebellar ataxia type 36 (OMIM 614153)AD100%GGCCTGIntron 13-14≥650
NOTCH2NLC Neuronal intranuclear inclusion disease (OMIM 603472)AD100%GGC 105' UTR<38≥66
NUTM2B-AS1 Oculopharyngeal myopathy with leukoencephalopathy 1 (OMIM 618637)AD100% 11CCGNoncoding RNA3-16>35
PABPN1 Oculopharyngeal muscular dystrophy AD100%GCN (Ala)Exon 11011-18
PHOX2B Congenital central hypoventilation syndrome AD92%GCN (Ala)Exon 3≤20≥24
PPP2R2B Spinocerebellar ataxia type 12 (OMIM 604326)AD100%CAGPromoter7-3151-78
PRDM12 Hereditary sensory and autonomic neuropathy type VIII (OMIM 616488)AR2 familiesGCC (Ala)Exon 57-1418-19
PRNP Creutzfeldt-Jakob disease AD<15%CCTCATGGTGGTGGCTGGGGGCAGExon 24 125-16
RAPGEF2 Familial adult myoclonic epilepsy type 7 (OMIM 618075)100%TTTCAIntron 140Unknown
RFC1 RFC1 CANVAS / spectrum disorder AR100%AAGGG 13Intron 211-200400 to >2000
RUNX2 Cleidocranial dysplasia spectrum disorder AD2 individuals 14GCN (Ala)Exon 11720-27
SAMD12 Familial adult myoclonic epilepsy type 1 (OMIM 601068)AD100%TTTCAIntron 40≥105
SOX3 Panhypopituitarism and intellectual disability with growth hormone deficiency (OMIM 300123)XL3 families 15GCN (Ala)Exon 1158 or 22-26
STARD7 Familial adult myoclonic epilepsy 2 (OMIM 607876)AD100%ATTTT/ATTTCIntron 1ATTTT ?;
ATTTC 0		ATTTT(>274)
ATTTC(>340)
TBP Spinocerebellar ataxia type 17 AD100%CAG or CAA (Gln)Exon 325-40≥49
TBX1 Tetralogy of Fallot (OMIM 602054)AD1 individualGCN (Ala)Exon 9c1525
TCF4 Fuchs endothelial corneal dystrophy (OMIM 613267)AD~70%CTG or CAGIntron 3<40See footnote 16.
TNRC6A Familial adult myoclonic epilepsy type 6 (OMIM 618074)AD100% 11TTTCAExon 1029
VWA1 Hereditary motor neuropathy (OMIM 619216)AR80%GGCGCGGAGCExon 121 or 3
XYLT1 Baratela-Scott syndrome (Desbuquois dysplasia type 2; OMIM 615777)~50%GGCPromoter9-20~>72
YEATS2 Familial adult myoclonic epilepsy 4 (OMIM 615127)AD100% 11TTTTA/TTTTCIntron 10192
ZIC2 Holoprosencephaly type 5 (See Holoprosencephaly Overview.)AD~40%GCN (Ala)Exon 31525
ZIC3 VACTERL (OMIM 300265)XL1 individualGCC (Ala)Exon 11012

The human genome includes >32,000 trinucleotide repeats of ≥6 repeated units. The human exome contains 1030 trinucleotide repeats in exons of 878 genes [Kozlowski et al 2010].

aa = amino acid; AD = autosomal dominant; ALS = amyotrophic lateral sclerosis; AR = autosomal recessive; ORF = open reading frame; MOI = mode of inheritance; UTR = untranslated region; XL = X-linked

1.

Proportion of pathogenic variants in this gene that are caused by a nucleotide repeat expansion or contraction

2.

Includes data derived from the subscription-based professional view of Human Gene Mutation Database [Stenson et al 2020]

3.

Penetrance is <100%; increased penetrance is reported for alleles of 54-250 CTA/CTG repeats. However, reduced penetrance has been reported at all allele sizes [Ranum et al 1999].

4.
5.
6.

This repeat comprises repeating units of 18 or 20 nucleotides that vary at a CA sequence.
• Normal repeat: CACA-20-nt(2-9)CA-18-nt(1)CACA-20-nt(1)CA-18-nt(1) – note, a normal allele has 5-12 total repeats.
• Abnormal allele: CACA-20-nt(1) CGCA-20-nt(12-13)CA-18-nt(1)CACA-20-nt(1)CA-18-nt(1) – note, a normal allele has 15-16 total repeats.
For the complete repeat sequence, see Favaro et al [2014].

7.
8.

Healthy controls were found to have 9-20 TTTTC repeats; TTTCA repeats were only present in pathogenic alleles.

9.

Duplication of one cytosine in a heptanucleotide cytosine tract within one copy of a 20-125 copy number VNTR (variable number tandem repeat). The specific VNTR involved varies by family but is consistent within a family.

10.

Reported as a GGC repeat [Sone et al 2019, Tian et al 2019] and as a CGG repeat [Ishiura et al 2019]

11.

Only one family reported to date

12.

Normal PRNP alleles have one nonapeptide followed by four octapeptide tandem repeat sequences, each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln.

13.

ACAGG repeat expansion (~1000 repeats) reported in three families [Scriba et al 2020, Tsuchiya et al 2020]

14.
15.
16.

Penetrance is <100%; reduced penetrance has been reported in individuals with >80 CTG repeats [Wieben et al 2014].

References

  • Délot E, King LM, Briggs MD, Wilcox WR, Cohn DH. Trinucleotide expansion mutations in the cartilage oligomeric matrix protein (COMP) gene. Hum Mol Genet. 1999;8:123–8. [PubMed: 9887340]
  • Favaro FP, Alvizi L, Zechi-Ceide RM, Bertola D, Felix TM, de Souza J, Raskin S, Twigg SR, Weiner AM, Armas P, Margarit E, Calcaterra NB, Andersen GR, McGowan SJ, Wilkie AO, Richieri-Costa A, de Almeida ML, Passos-Bueno MR. Am J Hum Genet. A noncoding expansion in EIF4A3 causes Richieri-Costa-Pereira syndrome, a craniofacial disorder associated with limb defects. 2014;94:120-8. [PMC free article: PMC3882729] [PubMed: 24360810]
  • Ishiura H, Shibata S, Yoshimura J, Suzuki Y, Qu W, Doi K, Almansour MA, Kikuchi JK, Taira M, Mitsui J, Takahashi Y, Ichikawa Y, Mano T, Iwata A, Harigaya Y, Matsukawa MK, Matsukawa T, Tanaka M, Shirota Y, Ohtomo R, Kowa H, Date H, Mitsue A, Hatsuta H, Morimoto S, Murayama S, Shiio Y, Saito Y, Mitsutake A, Kawai M, Sasaki T, Sugiyama Y, Hamada M, Ohtomo G, Terao Y, Nakazato Y, Takeda A, Sakiyama Y, Umeda-Kameyama Y, Shinmi J, Ogata K, Kohno Y, Lim SY, Tan AH, Shimizu J, Goto J, Nishino I, Toda T, Morishita S, Tsuji S. Noncoding CGG repeat expansions in neuronal intranuclear inclusion disease, oculopharyngodistal myopathy and an overlapping disease. Nat Genet. 2019;51:1222–32. [PubMed: 31332380]
  • Kekou K, Sofocleous C, Papadimas G, Petichakis D, Svingou M, Pons RM, Vorgia P, Gika A, Kitsiou-Tzeli S, Kanavakis E. A dynamic trinucleotide repeat (TNR) expansion in the DMD gene. Mol Cell Probes. 2016;30:254–60. [PubMed: 27417533]
  • Kozlowski P, de Mezer M, Krzyzosiak WJ. Trinucleotide repeats in human genome and exome. Nucleic Acids Res. 2010;38:4027–39. [PMC free article: PMC2896521] [PubMed: 20215431]
  • Ranum LPW, Moseley ML, Leppet MF, et al. Massive CTG expansions and deletions may reduce penetrance of spinocerebellar ataxia type 8. Am J Hum Genet. 1999;65:466.
  • Scriba CK, Beecroft SJ, Clayton JS, Cortese A, Sullivan R, Yau WY, Dominik N, Rodrigues M, Walker E, Dyer Z, Wu TY, Davis MR, Chandler DC, Weisburd B, Houlden H, Reilly MM, Laing NG, Lamont PJ, Roxburgh RH, Ravenscroft G. A novel RFC1 repeat motif (ACAGG) in two Asia-Pacific CANVAS families. Brain. 2020;143:2904–10. [PMC free article: PMC7780484] [PubMed: 33103729]
  • Shibata A, Machida J, Yamaguchi S, Kimura M, Tatematsu T, Miyachi H, Matsushita M, Kitoh H, Ishiguro N, Nakayama A, Higashi Y, Shimozato K, Tokita Y. Characterisation of novel RUNX2 mutation with alanine tract expansion from Japanese cleidocranial dysplasia patient. Mutagenesis. 2016;31:61–7. [PubMed: 26220009]
  • Sone J, Mitsuhashi S, Fujita A, Mizuguchi T, Hamanaka K, Mori K, Koike H, Hashiguchi A, Takashima H, Sugiyama H, Kohno Y, Takiyama Y, Maeda K, Doi H, Koyano S, Takeuchi H, Kawamoto M, Kohara N, Ando T, Ieda T, Kita Y, Kokubun N, Tsuboi Y, Katoh K, Kino Y, Katsuno M, Iwasaki Y, Yoshida M, Tanaka F, Suzuki IK, Frith MC, Matsumoto N, Sobue G. Long-read sequencing identifies GGC repeat expansions in NOTCH2NLC associated with neuronal intranuclear inclusion disease. Nat Genet. 2019;51:1215–21. [PubMed: 31332381]
  • Stenson PD, Mort M, Ball EV, Chapman M, Evans K, Azevedo L, Hayden M, Heywood S, Millar DS, Phillips AD, Cooper DN. The Human Gene Mutation Database (HGMD®): optimizing its use in a clinical diagnostic or research setting. Hum Genet. 2020;139:1197–207. [PMC free article: PMC7497289] [PubMed: 32596782]
  • Takagi M, Ishii T, Torii C, Kosaki K, Hasegawa T. A novel mutation in SOX3 polyalanine tract: a case of Kabuki syndrome with combined pituitary hormone deficiency harboring double mutations in MLL2 and SOX3. Pituitary. 2014;17:569–74. [PubMed: 24346842]
  • Tian Y, Wang JL, Huang W, Zeng S, Jiao B, Liu Z, Chen Z, Li Y, Wang Y, Min HX, Wang XJ, You Y, Zhang RX, Chen XY, Yi F, Zhou YF, Long HY, Zhou CJ, Hou X, Wang JP, Xie B, Liang F, Yang ZY, Sun QY, Allen EG, Shafik AM, Kong HE, Guo JF, Yan XX, Hu ZM, Xia K, Jiang H, Xu HW, Duan RH, Jin P, Tang BS, Shen L. Expansion of human-specific GGC repeat in neuronal intranuclear inclusion disease-related disorders. Am J Hum Genet. 2019;105:166–76. [PMC free article: PMC6612530] [PubMed: 31178126]
  • Tsuchiya M, Nan H, Koh K, Ichinose Y, Gao L, Shimozono K, Hata T, Kim YJ, Ohtsuka T, Cortese A, Takiyama Y. RFC1 repeat expansion in Japanese patients with late-onset cerebellar ataxia. J Hum Genet. 2020;65:1143–7. [PubMed: 32694621]
  • Wieben ED, Aleff RA, Eckloff BW, Atkinson EJ, Baheti S, Middha S, Brown WL, Patel SV, Kocher JP, Baratz KH. Comprehensive assessment of genetic variants within TCF4 in Fuchs' endothelial corneal dystrophy. Invest Ophthalmol Vis Sci. 2014;55:6101–7. [PMC free article: PMC4179444] [PubMed: 25168903]
Copyright © 1993-2024, University of Washington, Seattle. GeneReviews is a registered trademark of the University of Washington, Seattle. All rights reserved.

GeneReviews® chapters are owned by the University of Washington. Permission is hereby granted to reproduce, distribute, and translate copies of content materials for noncommercial research purposes only, provided that (i) credit for source (http://www.genereviews.org/) and copyright (© 1993-2024 University of Washington) are included with each copy; (ii) a link to the original material is provided whenever the material is published elsewhere on the Web; and (iii) reproducers, distributors, and/or translators comply with the GeneReviews® Copyright Notice and Usage Disclaimer. No further modifications are allowed. For clarity, excerpts of GeneReviews chapters for use in lab reports and clinic notes are a permitted use.

For more information, see the GeneReviews® Copyright Notice and Usage Disclaimer.

For questions regarding permissions or whether a specified use is allowed, contact: ude.wu@tssamda.

Bookshelf ID: NBK535148
GeneReviews by Title

Views

  • PubReader
  • Print View
  • Cite this Page
  • PDF version of this page (177K)
  • Disable Glossary Links

Bulk Download

GeneReviews Links

Related information

  • PMC
    PubMed Central citations
  • PubMed
    Links to PubMed

Recent Activity

ClearTurn OffTurn On

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...