TYMS Alleles

Common allele nameAlternative namesHGVS reference sequencedbSNP reference identifier for allele location
rs454456942R, 3R TYMS 5’UTRGRCh37.p13 chr 18, NC_000018.9:g.657657_657712del,
NC_000018.9:g.657657_657684GGCCTGCCTCCGTCCCGCCGCGCCACTT[1]-[9]#		 rs45445694
rs11280056TYMS 3’UTRGRCh37.p13 chr 18, NC_000018.9:g.673447_673452del, NC_000018.9:g.673447_673452dup#
NM_017512.7:c.*856_*861del		 rs11280056
rs2853542TYMS 3RG, 3RCGRCh37.p13 chr 18, NC_000018.9:g.657685G>C#

NM_001071.4:c.-58=

 rs2853542
#

This is a non-coding variant in the TYMS untranslated region. Coordinates given are chromosomal.

Pharmacogenetic Allele Nomenclature: International Workgroup Recommendations for Test Result Reporting (69).

Allele information for DPYD can also be found at the Pharmacogene Variation Consortium (PharmVar).

Guidelines for the description and nomenclature of gene variations are available from the Human Genome Variation Society (HGVS).

From: Fluorouracil Therapy and DPYD Genotype

Cover of Medical Genetics Summaries
Medical Genetics Summaries [Internet].
Pratt VM, Scott SA, Pirmohamed M, et al., editors.
Copyright Notice

All Medical Genetics Summaries content, except where otherwise noted, is licensed under a Creative Commons Attribution 4.0 International (CC BY 4.0) license which permits copying, distribution, and adaptation of the work, provided the original work is properly cited and any changes from the original work are properly indicated. Any altered, transformed, or adapted form of the work may only be distributed under the same or similar license to this one.

NCBI Bookshelf. A service of the National Library of Medicine, National Institutes of Health.