GEO Profile Links for Gene (Select 11651) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 3706

<< First< Prev

Page of 186

Next >Last >>

Select item 1295648171.

Akt1 - Double-knockout p53/PRKDC model of B cell acute lymphoblastic leukemia: leukemic blasts

Annotation:: Akt1, thymoma viral proto-oncogene 1

Organism:: Mus musculus

Reporter:: GPL1261, 1425711_a_at (ID_REF), GDS5640, 11651 (Gene ID), M94335

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 129564817

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1295557882.

Akt1 - Double-knockout p53/PRKDC model of B cell acute lymphoblastic leukemia: leukemic blasts

Annotation:: Akt1, thymoma viral proto-oncogene 1

Organism:: Mus musculus

Reporter:: GPL1261, 1416657_at (ID_REF), GDS5640, 11651 (Gene ID), NM_009652

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 129555788

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 618571173.

Akt1 - Isoproterenol-induced cardiomyopathy and exercise-induced cardiac hypertrophy

Annotation:: Akt1, thymoma viral proto-oncogene 1

Organism:: Mus musculus

Reporter:: GPL1261, 1425711_a_at (ID_REF), GDS3596, 11651 (Gene ID), M94335

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 61857117

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 341895064.

Akt1 - Breast cancer formation in WAP-SVT/t transgenic animals

Annotation:: Akt1, thymoma viral proto-oncogene 1

Organism:: Mus musculus

Reporter:: GPL339, 1425711_a_at (ID_REF), GDS2514, 11651 (Gene ID), M94335

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 34189506

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 341805885.

Akt1 - Breast cancer formation in WAP-SVT/t transgenic animals

Annotation:: Akt1, thymoma viral proto-oncogene 1

Organism:: Mus musculus

Reporter:: GPL339, 1416657_at (ID_REF), GDS2514, 11651 (Gene ID), NM_009652

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 34180588

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1303891696.

Akt1 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Akt1, thymoma viral proto-oncogene 1

Organism:: Mus musculus

Reporter:: GPL4134, 44169 (ID_REF), GDS5664, NM_009652, A_51_P237553 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130389169

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1303790257.

Akt1 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Akt1, thymoma viral proto-oncogene 1

Organism:: Mus musculus

Reporter:: GPL4134, 34025 (ID_REF), GDS5664, NM_009652, A_51_P237553 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130379025

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1303688048.

Akt1 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Akt1, thymoma viral proto-oncogene 1

Organism:: Mus musculus

Reporter:: GPL4134, 23804 (ID_REF), GDS5664, NM_009652, A_51_P237553 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130368804

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1303673169.

Akt1 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Akt1, thymoma viral proto-oncogene 1

Organism:: Mus musculus

Reporter:: GPL4134, 22316 (ID_REF), GDS5664, NM_009652, A_51_P237553 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130367316

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13036084310.

Akt1 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Akt1, thymoma viral proto-oncogene 1

Organism:: Mus musculus

Reporter:: GPL4134, 15843 (ID_REF), GDS5664, NM_009652, A_51_P237553 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130360843

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13036014911.

Akt1 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Akt1, thymoma viral proto-oncogene 1

Organism:: Mus musculus

Reporter:: GPL4134, 15149 (ID_REF), GDS5664, NM_009652, A_51_P237553 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130360149

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13035484112.

Akt1 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Akt1, thymoma viral proto-oncogene 1

Organism:: Mus musculus

Reporter:: GPL4134, 9841 (ID_REF), GDS5664, NM_009652, A_51_P237553 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130354841

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13034996813.

Akt1 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Akt1, thymoma viral proto-oncogene 1

Organism:: Mus musculus

Reporter:: GPL4134, 4968 (ID_REF), GDS5664, NM_009652, A_51_P237553 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130349968

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13034953414.

Akt1 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Akt1, thymoma viral proto-oncogene 1

Organism:: Mus musculus

Reporter:: GPL4134, 4534 (ID_REF), GDS5664, NM_009652, A_51_P237553 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130349534

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13034946715.

Akt1 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Akt1, thymoma viral proto-oncogene 1

Organism:: Mus musculus

Reporter:: GPL4134, 4467 (ID_REF), GDS5664, NM_009652, A_51_P237553 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130349467

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7367968816.

Akt1 - Trophoblast stem cell differentiation in vitro

Annotation:: Akt1, thymoma viral proto-oncogene 1

Organism:: Mus musculus

Reporter:: GPL1261, 1416657_at (ID_REF), GDS3948, 11651 (Gene ID), NM_009652

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 73679688

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 762929917.

Akt1 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Akt1, thymoma viral proto-oncogene 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCATCTGAACCTGATGTT (ID_REF), GDS878, NM_009652

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7629299

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12827678818.

Akt1 - NF-κB subunit p65 depletion effect on Ras-induced transformation model: cultured embryonic fibroblasts

Annotation:: Akt1, thymoma viral proto-oncogene 1

Organism:: Mus musculus

Reporter:: GPL1261, 1416657_at (ID_REF), GDS5608, 11651 (Gene ID), NM_009652

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 128276788

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12707736919.

Akt1 - 17β-estradiol effect on uterus of uterine epithelial ERα conditional knockout model: time course

Annotation:: Akt1, thymoma viral proto-oncogene 1

Organism:: Mus musculus

Reporter:: GPL4134, 44169 (ID_REF), GDS5461, NM_009652, A_51_P237553 (SPOT ID)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 127077369

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12706722520.

Akt1 - 17β-estradiol effect on uterus of uterine epithelial ERα conditional knockout model: time course

Annotation:: Akt1, thymoma viral proto-oncogene 1

Organism:: Mus musculus

Reporter:: GPL4134, 34025 (ID_REF), GDS5461, NM_009652, A_51_P237553 (SPOT ID)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 127067225

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 186

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 11651) (3706)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 3706

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity