nsv7093616
- Organism: Homo sapiens
- Study:nstd102 (Clinical Structural Variants)
- Variant Type:insertion
- Method Type:Multiple
- Submitted on:GRCh37, GRCh38
- Variant Calls:1
- Validation:Not tested
- Clinical Assertions: Yes
- Region Size:1
- Description:NM_000070.3(CAPN3):c.1974_1975insTTTTTTTTTTTTT
TTTTTTTNNNNNNNNNNGGTTCACGCCATTCTCCTGCCTCGGCCTCCCAAAGTGCTGG
GATTACAGGCGTGAGCCACCGCGCCCGGCCTCCGGAACATTTTC (p.Lys659fs) AND Autosomal recessive limb-girdle muscular dystrophy type 2A - Publication(s):Angelini et al. 2005
- Genome View
- Variant Region Details and Evidence
- Validation Information
- Clinical Assertions
- Genotype Information
Genome View
Select assembly:Overlapping variant regions from other studies: 79 SVs from 16 studies. See in: genome view
Overlapping variant regions from other studies: 79 SVs from 16 studies. See in: genome view
Variant Region Placement Information
Variant Region ID | Placement Type | Assembly | Assembly Unit | Sequence ID | Chr | Start | Stop |
---|---|---|---|---|---|---|---|
nsv7093616 | Submitted genomic | GRCh38 (hg38) | Primary Assembly | NC_000015.10 | Chr15 | 42,409,348 | 42,409,348 |
nsv7093616 | Submitted genomic | GRCh37 (hg19) | Primary Assembly | NC_000015.9 | Chr15 | 42,701,546 | 42,701,546 |
Variant Call Information
Variant Call ID | Type | Method | Analysis | Subject Phenotype | Clinical Interpretation | Source of Interpretation | ClinVar ID |
---|---|---|---|---|---|---|---|
nssv18786093 | insertion | Multiple | Multiple | Autosomal recessive limb-girdle muscular dystrophy type 2A; Calpainopathy; Limb-girdle muscular dystrophy, type 2A; MUSCULAR DYSTROPHY, LIMB-GIRDLE, AUTOSOMAL RECESSIVE 1; LGMDR1 | Pathogenic | ClinVar | RCV002843873.1, VCV002016386.1 |
Variant Call Placement Information
Variant Call ID | Placement Type | HGVS | Assembly | Sequence ID | Chr | Start | Stop |
---|---|---|---|---|---|---|---|
nssv18786093 | Submitted genomic | NC_000015.10:g.424 09348_42409349ins1 15 | GRCh38 (hg38) | NC_000015.10 | Chr15 | 42,409,348 | 42,409,348 |
nssv18786093 | Submitted genomic | NC_000015.9:g.4270 1546_42701547ins11 5 | GRCh37 (hg19) | NC_000015.9 | Chr15 | 42,701,546 | 42,701,546 |
No validation data were submitted for this variant
Clinical Assertions
Variant Call ID | HGVS | Type | Allele Origin | Subject Phenotype | Clinical Interpretation | Source of Interpretation | ClinVar ID |
---|---|---|---|---|---|---|---|
nssv18786093 | GRCh37: NC_000015.9:g.42701546_42701547ins115, GRCh38: NC_000015.10:g.42409348_42409349ins115 | insertion | germline | Autosomal recessive limb-girdle muscular dystrophy type 2A; Calpainopathy; Limb-girdle muscular dystrophy, type 2A; MUSCULAR DYSTROPHY, LIMB-GIRDLE, AUTOSOMAL RECESSIVE 1; LGMDR1 | Pathogenic | ClinVar | RCV002843873.1, VCV002016386.1 |