nsv7093613
- Organism: Homo sapiens
- Study:nstd102 (Clinical Structural Variants)
- Variant Type:insertion
- Method Type:Multiple
- Submitted on:GRCh37, GRCh38
- Variant Calls:1
- Validation:Not tested
- Clinical Assertions: Yes
- Region Size:1
- Description:NM_015346.4(ZFYVE26):c.2451_2452insGTCTATAGGAG
CTTGTGTTTTGCTGTAGAAGGAGCAGCAGGTGTCATAGTTATTCATTATCCTCTGTCT
CTAACTACACAGATCTTGGCTGTCAAGCCAACTTCACACTTCCTACTCTATAAGGAGC
TGATAATTGACTTTCTCTCTTCTTCCCAATACCTGTAGATGGCCGAGACTACAGG (p.His818delinsValTyrArgSerLeuCysPheAlaValGluGlyAlaAlaGlyValIleValIleHisTyrProLeuSerLeuThrThrGlnIleLeuAlaValLysProThrSerHisPheLeuLeuTyrLysGluLeuIleIleAspPheLeuSerSerSerGlnTyrLeuTer) AND Spastic paraplegia
- Genome View
- Variant Region Details and Evidence
- Validation Information
- Clinical Assertions
- Genotype Information
Genome View
Select assembly:Overlapping variant regions from other studies: 75 SVs from 15 studies. See in: genome view
Overlapping variant regions from other studies: 75 SVs from 15 studies. See in: genome view
Variant Region Placement Information
| Variant Region ID | Placement Type | Assembly | Assembly Unit | Sequence ID | Chr | Start | Stop |
|---|---|---|---|---|---|---|---|
| nsv7093613 | Submitted genomic | GRCh38 (hg38) | Primary Assembly | NC_000014.9 | Chr14 | 67,793,709 | 67,793,709 |
| nsv7093613 | Submitted genomic | GRCh37 (hg19) | Primary Assembly | NC_000014.8 | Chr14 | 68,260,426 | 68,260,426 |
Variant Call Information
| Variant Call ID | Type | Method | Analysis | Subject Phenotype | Clinical Interpretation | Source of Interpretation | ClinVar ID |
|---|---|---|---|---|---|---|---|
| nssv18786172 | insertion | Multiple | Multiple | Spastic paraplegia; Spastic paraplegia | Pathogenic | ClinVar | RCV003048260.1, VCV002131543.1 |
Variant Call Placement Information
| Variant Call ID | Placement Type | HGVS | Assembly | Sequence ID | Chr | Start | Stop |
|---|---|---|---|---|---|---|---|
| nssv18786172 | Submitted genomic | NC_000014.9:g.6779 3709_67793710ins18 2 | GRCh38 (hg38) | NC_000014.9 | Chr14 | 67,793,709 | 67,793,709 |
| nssv18786172 | Submitted genomic | NC_000014.8:g.6826 0426_68260427ins18 2 | GRCh37 (hg19) | NC_000014.8 | Chr14 | 68,260,426 | 68,260,426 |
No validation data were submitted for this variant
Clinical Assertions
| Variant Call ID | HGVS | Type | Allele Origin | Subject Phenotype | Clinical Interpretation | Source of Interpretation | ClinVar ID |
|---|---|---|---|---|---|---|---|
| nssv18786172 | GRCh37: NC_000014.8:g.68260426_68260427ins182, GRCh38: NC_000014.9:g.67793709_67793710ins182 | insertion | germline | Spastic paraplegia; Spastic paraplegia | Pathogenic | ClinVar | RCV003048260.1, VCV002131543.1 |