ClinVar Genomic variation as it relates to human health
NM_007294.4(BRCA1):c.5307_5308insCACCAACATGCCCTTCACCT (p.Gly1770fs)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_007294.4(BRCA1):c.5307_5308insCACCAACATGCCCTTCACCT (p.Gly1770fs)
Variation ID: 1697284 Accession: VCV001697284.1
- Type and length
-
Insertion, 20 bp
- Location
-
Cytogenetic: 17q21.31 17: 43051087-43051088 (GRCh38) [ NCBI UCSC ] 17: 41203104-41203105 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Jul 23, 2022 Jul 23, 2022 Jul 14, 2022 - HGVS
- ... more HGVS ... less HGVS
- Protein change
- G1723fs, G1770fs, G1791fs, G666fs
- Other names
- -
- Canonical SPDI
- NC_000017.11:43051087:A:AGGTGAAGGGCATGTTGGTGA
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
- probably has functional consequence
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
- Links
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
BRCA1 | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
12881 | 14666 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Likely pathogenic (1) |
criteria provided, single submitter
|
Jul 14, 2022 | RCV002267668.1 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Likely pathogenic
(Jul 14, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Breast-ovarian cancer, familial, susceptibility to, 1
(Autosomal dominant inheritance)
Affected status: yes
Allele origin:
germline
|
Laboratorio de Genetica Molecular e Citogenetica, Universidade Federal de Goias
Accession: SCV002547449.1
First in ClinVar: Jul 23, 2022 Last updated: Jul 23, 2022 |
Comment:
The variant c. 5305_5306insGGTGAAGGGCATGTTGGTGA in the BRCA1 gene was the only variant reported in a female patient diagnosed with breast cancer at age 31 and … (more)
The variant c. 5305_5306insGGTGAAGGGCATGTTGGTGA in the BRCA1 gene was the only variant reported in a female patient diagnosed with breast cancer at age 31 and with a history of cancer. The frameshift variant causes a premature stop codon 31 codons after insertion (p.Tyr1769Phefs*31). The variant is predicted to create a null allele in a gene where loss of function is a known disease-causing mechanism (PMID: 27535533) and is a variant absent in controls (PMID: 18571414). (less)
Indication for testing: Patient with clinical criteria for HBOC syndrome according to NCCN 2022/1
Age: 30-39 years
Sex: female
Ethnicity/Population group: Brazilian
Geographic origin: Goiânia
Comment on evidence:
patient with luminal breast cancer diagnosed at age 31. The patient's mother had breast cancer diagnosed at age 47 and a maternal great-uncle had prostate … (more)
patient with luminal breast cancer diagnosed at age 31. The patient's mother had breast cancer diagnosed at age 47 and a maternal great-uncle had prostate cancer. The patient met clinical criteria for HBOC syndrome and Li-Fraumeni syndrome. The variant c.5305_5306insGGTGAAGGGCATGTTGGTGA was found in the DNA sample. (less)
Testing laboratory: Sophia Genetics
Date variant was reported to submitter: 2019-04-09
Testing laboratory interpretation: Likely pathogenic
|
Germline Functional Evidence
Functional
Help
The functional consequence of the variant, based on experimental evidence and provided by the submitter. consequence |
Method
Help
A brief description of the method used to determine the functional consequence of the variant. A citation for the method is included, when provided by the submitter. |
Result
Help
A brief description of the result of this method for this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting functional evidence for the germline classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
---|---|---|---|---|
probably has functional consequence
|
Laboratorio de Genetica Molecular e Citogenetica, Universidade Federal de Goias
Accession: SCV002547449.1
|
|
Citations for germline classification of this variant
HelpTitle | Author | Journal | Year | Link |
---|---|---|---|---|
Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. | Richards S | Genetics in medicine : official journal of the American College of Medical Genetics | 2015 | PMID: 25741868 |
Text-mined citations for rs2153069688 ...
HelpRecord last updated Mar 30, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.