"COL11A2-related disorder"[Disease/phenotype] AND "PreventionGenetics, - ClinVar

Search results

Items: 90

	Variation	Gene (Protein Change)	Type (Consequence)	Condition	Classification, Review status
Select item 391882	NM_080680.3(COL11A2):c.5160C>G (p.Ala1720=)	COL11A2	Single nucleotide variant (synonymous variant)	COL11A2-related disorder +2 more	GBenign/Likely benign
Select item 3031757	NM_080680.3(COL11A2):c.5131C>T (p.Leu1711=)	COL11A2	Single nucleotide variant (synonymous variant)	COL11A2-related disorder	GLikely benign
Select item 1217667	NM_080680.3(COL11A2):c.5113C>T (p.Leu1705=)	COL11A2	Single nucleotide variant (synonymous variant)	not provided +1 more	GLikely benign
Select item 291006	NM_080680.3(COL11A2):c.5106G>A (p.Thr1702=)	COL11A2	Single nucleotide variant (synonymous variant)	COL11A2-related disorder +2 more	GConflicting classifications of pathogenicity
Select item 1300806	NM_080680.3(COL11A2):c.5087C>T (p.Thr1696Met)	COL11A2 (T1589M +2 more)	Single nucleotide variant (missense variant)	COL11A2-related disorder +1 more	GConflicting classifications of pathogenicity
Select item 262312	NM_080680.3(COL11A2):c.5071-7C>G	COL11A2	Single nucleotide variant (intron variant)	Otospondylomegaepiphyseal dysplasia, autosomal dominant +4 more	GConflicting classifications of pathogenicity
Select item 1211399	NM_080680.3(COL11A2):c.5028G>A (p.Pro1676=)	COL11A2	Single nucleotide variant (synonymous variant)	COL11A2-related disorder +1 more	GBenign/Likely benign
Select item 498728	NM_080680.3(COL11A2):c.4950C>T (p.Asp1650=)	COL11A2	Single nucleotide variant (synonymous variant)	not provided +3 more	GBenign/Likely benign
Select item 517184	NM_080680.3(COL11A2):c.4924C>G (p.Leu1642Val)	COL11A2 (L1642V +2 more)	Single nucleotide variant (missense variant)	not specified +2 more	GUncertain significance
Select item 178663	NM_080680.3(COL11A2):c.4884G>C (p.Glu1628Asp)	COL11A2 (E1628D +2 more)	Single nucleotide variant (missense variant)	Connective tissue disorder +7 more	GBenign/Likely benign
Select item 1179776	NM_080680.3(COL11A2):c.4864-58CCCTCTGAGGCCAGCCCTCTCTCTCC[3]	COL11A2	Microsatellite (intron variant)	COL11A2-related disorder +1 more	GLikely benign
Select item 681034	NM_080680.3(COL11A2):c.4864-32_4864-7del	COL11A2	Microsatellite (intron variant)	COL11A2-related disorder +1 more	GLikely benign
Select item 178924	NM_080680.3(COL11A2):c.4863+7G>A	COL11A2	Single nucleotide variant (intron variant)	not specified +2 more	GConflicting classifications of pathogenicity
Select item 1170925	NM_080680.3(COL11A2):c.4860G>A (p.Thr1620=)	COL11A2	Single nucleotide variant (synonymous variant)	not provided +1 more	GBenign/Likely benign
Select item 227272	NM_080680.3(COL11A2):c.4751-9A>G	COL11A2	Single nucleotide variant (intron variant)	Connective tissue disorder +7 more	GConflicting classifications of pathogenicity
Select item 356383	NM_080680.3(COL11A2):c.4651C>T (p.Arg1551Trp)	COL11A2 (R1551W +2 more)	Single nucleotide variant (missense variant)	Fibrochondrogenesis 2 +6 more	GConflicting classifications of pathogenicity
Select item 3030712	NM_080680.3(COL11A2):c.4599C>G (p.Ala1533=)	COL11A2	Single nucleotide variant (synonymous variant)	COL11A2-related disorder	GLikely benign
Select item 667099	NM_080680.3(COL11A2):c.4545G>A (p.Ser1515=)	COL11A2	Single nucleotide variant (synonymous variant)	COL11A2-related disorder +2 more	GLikely benign
Select item 1223118	NM_080680.3(COL11A2):c.4544C>T (p.Ser1515Leu)	COL11A2 (S1408L +2 more)	Single nucleotide variant (missense variant)	COL11A2-related disorder +1 more	GConflicting classifications of pathogenicity
Select item 1562583	NM_080680.3(COL11A2):c.4428+8A>T	COL11A2	Single nucleotide variant (intron variant)	not provided +1 more	GLikely benign
Select item 1428912	NM_080680.3(COL11A2):c.4392C>T (p.Pro1464=)	COL11A2	Single nucleotide variant (synonymous variant)	COL11A2-related disorder +1 more	GConflicting classifications of pathogenicity
Select item 226537	NM_080680.3(COL11A2):c.4383C>T (p.Pro1461=)	COL11A2	Single nucleotide variant (synonymous variant)	not provided +6 more	GConflicting classifications of pathogenicity
Select item 1928914	NM_080680.3(COL11A2):c.4231-4C>A	COL11A2	Single nucleotide variant (intron variant)	not provided +1 more	GLikely benign
Select item 178925	NM_080680.3(COL11A2):c.4206C>T (p.Gly1402=)	COL11A2	Single nucleotide variant (synonymous variant)	not specified +2 more	GLikely benign
Select item 1543984	NM_080680.3(COL11A2):c.4107G>A (p.Gly1369=)	COL11A2	Single nucleotide variant (synonymous variant)	not provided +1 more	GLikely benign
Select item 517523	NM_080680.3(COL11A2):c.4026C>T (p.Gly1342=)	COL11A2	Single nucleotide variant (synonymous variant)	not specified +2 more	GLikely benign
Select item 391881	NM_080680.3(COL11A2):c.4015-8T>C	COL11A2	Single nucleotide variant (intron variant)	COL11A2-related disorder +2 more	GBenign/Likely benign
Select item 1470872	NM_080680.3(COL11A2):c.3967G>A (p.Ala1323Thr)	COL11A2 (A1237T +2 more)	Single nucleotide variant (missense variant)	not provided +1 more	GUncertain significance
Select item 178812	NM_080680.3(COL11A2):c.3932A>G (p.Asn1311Ser)	COL11A2 (N1311S +2 more)	Single nucleotide variant (missense variant)	not provided +6 more	GConflicting classifications of pathogenicity
Select item 2197391	NM_080680.3(COL11A2):c.3906+7G>A	COL11A2	Single nucleotide variant (intron variant)	not provided +1 more	GConflicting classifications of pathogenicity
Select item 2174890	NM_080680.3(COL11A2):c.3748C>T (p.Pro1250Ser)	COL11A2 (P1143S +2 more)	Single nucleotide variant (missense variant)	not provided +1 more	GConflicting classifications of pathogenicity
Select item 2636531	NM_080680.3(COL11A2):c.3743C>T (p.Pro1248Leu)	COL11A2 (P1141L +6 more)	Single nucleotide variant (missense variant)	COL11A2-related disorder +1 more	GConflicting classifications of pathogenicity
Select item 2959123	NM_080680.3(COL11A2):c.3666del (p.Ile1223fs)	COL11A2 (I541fs +6 more)	Deletion (frameshift variant)	not provided +1 more	GPathogenic/Likely pathogenic
Select item 356390	NM_080680.3(COL11A2):c.3654A>G (p.Ser1218=)	COL11A2	Single nucleotide variant (synonymous variant)	Fibrochondrogenesis 2 +6 more	GConflicting classifications of pathogenicity
Select item 178325	NM_080680.3(COL11A2):c.3616C>T (p.Leu1206=)	COL11A2	Single nucleotide variant (synonymous variant)	Stickler Syndrome, Dominant +6 more	GConflicting classifications of pathogenicity
Select item 162982	NM_080680.3(COL11A2):c.3583-3C>T	COL11A2	Single nucleotide variant (intron variant)	COL11A2-related disorder +2 more	GConflicting classifications of pathogenicity
Select item 2888776	NM_080680.3(COL11A2):c.3583-7C>T	COL11A2	Single nucleotide variant (intron variant)	not provided +1 more	GLikely benign
Select item 2631555	NM_080680.3(COL11A2):c.3422G>C (p.Gly1141Ala)	COL11A2 (G1034A +6 more)	Single nucleotide variant (missense variant)	COL11A2-related disorder	GLikely pathogenic
Select item 1309169	NM_080680.3(COL11A2):c.3365C>T (p.Ala1122Val)	COL11A2 (A1015V +2 more)	Single nucleotide variant (missense variant)	COL11A2-related disorder +1 more	GUncertain significance
Select item 3053088	NM_080680.3(COL11A2):c.3259-4C>G	COL11A2	Single nucleotide variant (intron variant)	COL11A2-related disorder	GLikely benign
Select item 434809	NM_080680.3(COL11A2):c.3173C>T (p.Pro1058Leu)	COL11A2 (P1058L +2 more)	Single nucleotide variant (missense variant)	COL11A2-related disorder +2 more	GConflicting classifications of pathogenicity
Select item 3030529	NM_080680.3(COL11A2):c.3150+8T>G	COL11A2	Single nucleotide variant (intron variant)	COL11A2-related disorder	GLikely benign
Select item 17124	NM_080680.3(COL11A2):c.3100C>T (p.Arg1034Cys)	COL11A2 (R1034C +2 more)	Single nucleotide variant (missense variant)	not provided +2 more	GPathogenic/Likely pathogenic
Select item 1157473	NM_080680.3(COL11A2):c.3021G>A (p.Pro1007=)	COL11A2	Single nucleotide variant (synonymous variant)	COL11A2-related disorder +1 more	GLikely benign
Select item 1687700	NM_080680.3(COL11A2):c.3020C>T (p.Pro1007Leu)	COL11A2 (P1007L +2 more)	Single nucleotide variant (missense variant)	COL11A2-related disorder +1 more	GConflicting classifications of pathogenicity
Select item 227268	NM_080680.3(COL11A2):c.2928G>A (p.Gly976=)	COL11A2	Single nucleotide variant (synonymous variant)	not provided +2 more	GLikely benign
Select item 1465012	NM_080680.3(COL11A2):c.2899G>A (p.Gly967Ser)	COL11A2 (G860S +2 more)	Single nucleotide variant (missense variant)	not provided +1 more	GUncertain significance
Select item 2807113	NM_080680.3(COL11A2):c.2820G>A (p.Gly940=)	COL11A2	Single nucleotide variant (synonymous variant)	COL11A2-related disorder +1 more	GLikely benign
Select item 513695	NM_080680.3(COL11A2):c.2709G>A (p.Pro903=)	COL11A2	Single nucleotide variant (synonymous variant)	COL11A2-related disorder +4 more	GConflicting classifications of pathogenicity
Select item 178327	NM_080680.3(COL11A2):c.2682G>A (p.Pro894=)	COL11A2	Single nucleotide variant (synonymous variant)	not provided +5 more	GConflicting classifications of pathogenicity
Select item 1455992	NM_080680.3(COL11A2):c.2554C>T (p.Arg852Ter)	COL11A2 (R745* +2 more)	Single nucleotide variant (nonsense)	not provided +1 more	GPathogenic/Likely pathogenic
Select item 2046770	NM_080680.3(COL11A2):c.2529G>A (p.Thr843=)	COL11A2	Single nucleotide variant (synonymous variant)	not provided +1 more	GConflicting classifications of pathogenicity
Select item 1365894	NM_080680.3(COL11A2):c.2425C>G (p.Pro809Ala)	COL11A2 (P702A +2 more)	Single nucleotide variant (missense variant)	COL11A2-related disorder +1 more	GConflicting classifications of pathogenicity
Select item 1304928	NM_080680.3(COL11A2):c.2327G>A (p.Arg776His)	COL11A2 (R669H +2 more)	Single nucleotide variant (missense variant)	COL11A2-related disorder +1 more	GConflicting classifications of pathogenicity
Select item 356400	NM_080680.3(COL11A2):c.2271C>T (p.Gly757=)	COL11A2	Single nucleotide variant (synonymous variant)	not provided +6 more	GConflicting classifications of pathogenicity
Select item 516244	NM_080680.3(COL11A2):c.2268+8G>A	COL11A2	Single nucleotide variant (intron variant)	not specified +2 more	GLikely benign
Select item 1188167	NM_080680.3(COL11A2):c.2266A>C (p.Arg756=)	COL11A2	Single nucleotide variant (synonymous variant)	COL11A2-related disorder +1 more	GLikely benign
Select item 682617	NM_080680.3(COL11A2):c.2187G>C (p.Arg729=)	COL11A2	Single nucleotide variant (synonymous variant)	not provided +1 more	GLikely benign
Select item 2630899	NM_080680.3(COL11A2):c.2017G>T (p.Gly673Cys)	COL11A2 (G331C +5 more)	Single nucleotide variant (missense variant +1 more)	COL11A2-related disorder	GUncertain significance
Select item 195909	NM_080680.3(COL11A2):c.2017-5T>G	COL11A2	Single nucleotide variant (intron variant)	Connective tissue disorder +3 more	GConflicting classifications of pathogenicity
Select item 1216332	NM_080680.3(COL11A2):c.1998C>T (p.Ile666=)	COL11A2	Single nucleotide variant (synonymous variant)	COL11A2-related disorder +1 more	GLikely benign
Select item 2046765	NM_080680.3(COL11A2):c.1923C>G (p.Pro641=)	COL11A2	Single nucleotide variant (synonymous variant)	not provided +1 more	GLikely benign
Select item 3036974	NM_080680.3(COL11A2):c.1798C>T (p.Arg600Ter)	COL11A2 (R258* +5 more)	Single nucleotide variant (nonsense)	COL11A2-related disorder	GLikely pathogenic
Select item 512790	NM_080680.3(COL11A2):c.1720-4G>T	COL11A2	Single nucleotide variant (intron variant)	not specified +2 more	GConflicting classifications of pathogenicity
Select item 227261	NM_080680.3(COL11A2):c.1716T>C (p.His572=)	COL11A2	Single nucleotide variant (synonymous variant)	not specified +2 more	GLikely benign
Select item 809916	NM_080680.3(COL11A2):c.1698C>T (p.Leu566=)	COL11A2	Single nucleotide variant (synonymous variant)	not provided +4 more	GConflicting classifications of pathogenicity
Select item 1579675	NM_080680.3(COL11A2):c.1443G>C (p.Ala481=)	COL11A2	Single nucleotide variant (synonymous variant)	COL11A2-related disorder +1 more	GLikely benign
Select item 1307824	NM_080680.3(COL11A2):c.1292C>G (p.Pro431Arg)	COL11A2 (P324R +2 more)	Single nucleotide variant (missense variant)	COL11A2-related disorder +1 more	GUncertain significance
Select item 1804608	NM_080680.3(COL11A2):c.1132C>A (p.Pro378Thr)	COL11A2 (P271T +2 more)	Single nucleotide variant (missense variant)	not provided +1 more	GUncertain significance
Select item 228527	NM_080680.3(COL11A2):c.1119+1G>C	COL11A2	Single nucleotide variant (intron variant +1 more)	not specified +1 more	GConflicting classifications of pathogenicity
Select item 1505003	NM_080680.3(COL11A2):c.1119C>T (p.Ala373=)	COL11A2	Single nucleotide variant (synonymous variant +1 more)	not provided +1 more	GConflicting classifications of pathogenicity
Select item 227273	NM_080680.3(COL11A2):c.966C>A (p.Pro322=)	COL11A2	Single nucleotide variant (synonymous variant +1 more)	COL11A2-related disorder +3 more	GLikely benign
Select item 2886782	NM_080680.3(COL11A2):c.960C>T (p.Val320=)	COL11A2	Single nucleotide variant (synonymous variant +1 more)	not provided +1 more	GLikely benign
Select item 682610	NM_080680.3(COL11A2):c.882C>T (p.Pro294=)	COL11A2	Single nucleotide variant (synonymous variant +1 more)	not provided +1 more	GLikely benign
Select item 561281	NM_080680.3(COL11A2):c.813C>T (p.Leu271=)	COL11A2	Single nucleotide variant (synonymous variant +1 more)	Connective tissue disorder +2 more	GLikely benign
Select item 162995	NM_080680.3(COL11A2):c.798+38C>A	COL11A2 (P279H)	Single nucleotide variant (missense variant +1 more)	not specified +2 more	GBenign/Likely benign
Select item 1598523	NM_080680.3(COL11A2):c.792G>A (p.Gln264=)	COL11A2	Single nucleotide variant (synonymous variant)	not provided +1 more	GLikely benign
Select item 225318	NM_080680.3(COL11A2):c.688G>T (p.Gly230Trp)	COL11A2 (G230W)	Single nucleotide variant (missense variant)	COL11A2-related disorder +9 more	GConflicting classifications of pathogenicity
Select item 451783	NM_080680.3(COL11A2):c.587T>C (p.Leu196Pro)	COL11A2 (L196P)	Single nucleotide variant (missense variant)	COL11A2-related disorder +2 more	GConflicting classifications of pathogenicity
Select item 681633	NM_080680.3(COL11A2):c.579C>T (p.Ala193=)	COL11A2	Single nucleotide variant (synonymous variant)	not provided +4 more	GConflicting classifications of pathogenicity
Select item 197366	NM_080680.3(COL11A2):c.480T>G (p.Ser160=)	COL11A2	Single nucleotide variant (synonymous variant)	not provided +2 more	GConflicting classifications of pathogenicity
Select item 2186503	NM_080680.3(COL11A2):c.419G>A (p.Arg140Gln)	COL11A2 (R140Q)	Single nucleotide variant (missense variant)	not provided +1 more	GUncertain significance
Select item 287840	NM_080680.3(COL11A2):c.390G>C (p.Arg130=)	COL11A2	Single nucleotide variant (synonymous variant)	COL11A2-related disorder +2 more	GBenign/Likely benign
Select item 1412522	NM_080680.3(COL11A2):c.353G>A (p.Arg118Gln)	COL11A2 (R118Q)	Single nucleotide variant (missense variant)	COL11A2-related disorder +1 more	GUncertain significance
Select item 287843	NM_080680.3(COL11A2):c.329G>A (p.Arg110Gln)	COL11A2 (R110Q)	Single nucleotide variant (missense variant)	COL11A2-related disorder +2 more	GBenign/Likely benign
Select item 228533	NM_080680.3(COL11A2):c.233-8G>T	COL11A2	Single nucleotide variant (intron variant)	COL11A2-related disorder +2 more	GConflicting classifications of pathogenicity
Select item 3061690	NM_080680.3(COL11A2):c.201G>A (p.Gln67=)	COL11A2	Single nucleotide variant (synonymous variant +2 more)	COL11A2-related disorder	GLikely benign
Select item 1200328	NM_080680.3(COL11A2):c.144G>A (p.Arg48=)	COL11A2	Single nucleotide variant (synonymous variant)	COL11A2-related disorder +1 more	GLikely benign
Select item 2999974	NM_080680.3(COL11A2):c.45T>G (p.Pro15=)	COL11A2	Single nucleotide variant (synonymous variant +1 more)	COL11A2-related disorder +1 more	GLikely benign
Select item 2919752	NM_080680.3(COL11A2):c.30C>G (p.Leu10=)	COL11A2	Single nucleotide variant (synonymous variant +1 more)	not provided +1 more	GLikely benign

ClinVar

Result Filters

Classification type

Germline classification

Types of conflicts

Molecular consequence

Variation type

Variation size

Variant length

Review status

Additional filters

Search results

Items: 90