dbSNP has three submission options for information about variations:

dbSNP has three submission templates that are used to submit information about variations:

1.

The SNPASSAY template is used to describe a new variation. dbSNP accepts all variations types, including single and multiple nucleotide substitutions, insertions and deletions, microsatellites, and named variations.

2.

The SNPPOPUSE template is used to submit allele and/or genotype frequencies for a sampled population. The name “SNPPOPUSE” derives from the fact that the data submitted using this form is data for a SNP that is tested or assayed in a population.

3.

The SNPINDUSE template is used to submit actual genotypes for assayed individuals. The name “SNPINDUSE” derives from the fact that the data submitted using this form is data for a SNP that is tested or assayed in an individual.

All three submission templates are in “templates_SNPsub.xls”, located in the submission file, which can be found in the /specs subdirectory of the dbSNP FTP site. (ud: 3/21/08)

You will need to fill out at least the SNPASSAY worksheet, and depending on whether you have individual or frequency data, you can fill out either the SNPINDUSE or the SNPPOPUSE woksheets. SNPINDUSE would be preferred if you have individual genotype data.

Submit all four SNPs using just a single SNPAssay worksheet. There is a good example of such a submission available online. (7/23/07)

Please look at the dbSNP Submission Quick Start for information on copying the template; once you have a copy, fill in column “B” so that your submission, when submitted, will is formatted similarly to this example. (05/15/08)

You will need to fill out at least the SNPASSAY worksheet, and depending on whether you have individual or frequency data, you can fill out either the SNPINDUSE or the SNPPOPUSE worksheets. SNPINDUSE would be preferred if you have individual genotype data.

You do not need to repeat the CONTACT, METHOD, or POPULATION sections if they are the same for the SNPASSAY, SNPINDUSE, and SNPPOPUSE worksheets.

dbSNP assigns the ss and rs numbers after your submission has been loaded (ss) and clustered (rs). In the meantime, you can use your local SNP ID/name instead of an ss number or rs number when reporting genotype (SNPINDUSE) or frequency data (SNPPOPUSE). (5/16/05)

You can put the description of amino acid change in the COMMENT tag for each SNP. Here is an example:

SNP: lp02849
ACCESSION: AF050163
LENGTH: 101
COMMENT: a nucleotide substitution in exon 6 resulting in an N291S amino 
acid change in LPL
5'_assay:CTGCTTGAGTTGTAGAAAGAACCGCTGCAACAATCTGGGCTATGAGATCA
OBSERVED: A/G
3'_assay:TAAAGTCAGAGCCAAAAGAAGCAGCAAAATGTACCTGAAGACTCGTTCTC

(2/25/05)

The CONT, PUB, METHOD sections should appear once. Place them on top of the submission in the order listed.

For the “ID” space in the METHOD section, you or your lab would choose a unique name/ID or local identifier for the method (e.g., “Sequencing Protocol 123123”, “LAB Sequencing Protocol”, or “SNP detection”). For the “ID” space in the POPULATION section, you or your lab would again choose a unique name/ID or local identifier—this time for the population (e.g., “Male Caucasians”). For the BATCH space in the SNPASSAY section, you or your lab would again choose a unique name/ID or local identifier—this time for the SNPASSAY batch (e.g., “07092004” or “BRCA1-SNPs”).

Yes. Submit for each of the 3 sources.

The BATCH ID is a user-defined name for the batch of SNPs being submitted. The BATCH ID should be unique for each submission.

My understanding is that there are no genetic variations within Drosophila melanogaster stocks, and that variations are therefore assayed between the stocks. Since this is the case, you can treat each stock as an individual.

The submission format looks like this:

TYPE: INDIVIDUAL

IND:handle|loc_pop_id|loc_ind_id|tax_id|sex|breed_structure|loc_ind_grp

SOURCE: src_type|source_name|src_ind_id|src_ind_grp

PEDIGREE: curator|curator_ped_id|curator_ind_id|ma_ind_id|pa_ind_id ||

Please note: src_ind_grp is any grouping that the Source gives to this sample (e.g. coriell calls CEPH samples "Caucasian"). loc_ind_grp is any grouping that the submitter gives to the sample (e.g. HapMap calls CEPH samples "European". You could call it “Plate_1” or whatever makes sense. (9/12/07)

The SNPINDUSE worksheet is for reporting the genotype of the breed or strain of a SNP reported in the SNPASSAY section. The SNPPOPUSE worksheet is for reporting SNP allele frequency observed in a population. (5/16/05)

You can use the individual or sample IDs provided by the source (i.e. CEPH, Coriell, etc.). Please see the “Individual Description Section” of the online dbSNP submission documentation (9/19/06)

dbSNP assigns the ss and rs numbers after your submission has been loaded (ss) and clustered (rs). In the meantime, you can use your local SNP ID/name instead of an ss number or rs number when reporting genotype (SNPINDUSE) or frequency data (SNPPOPUSE). (5/16/05)

You will need to fill out at least the SNPASSAY worksheet, and depending on whether you have individual or frequency data, you can fill out either the SNPINDUSE or the SNPPOPUSE section. SNPINDUSE would be preferred if you have individual genotype data.

Yes, gender can be blank and the Pedigree elements are optional. (7/27/07)

The SNPINDUSE field is for reporting the genotype of the breed or strain of a SNP reported in the SNPASSAY section. The SNPPOPUSE field is for reporting SNP allele frequency observed in a population. (5/16/05)

The SNPPOPUSE header is defined once for each batch and appears only once and is followed immediately by the frequency data for the batch.

You will need to fill out at least the SNPASSAY worksheet, and depending on whether you have individual or frequency data, you can fill out either the SNPINDUSE or the SNPPOPUSE section. SNPINDUSE would be preferred if you have individual genotype data.

dbSNP assigns the ss and rs numbers after your submission has been loaded (ss) and clustered (rs). In the meantime, you can use your local SNP ID/name instead of an ss number or rs number when reporting genotype (SNPINDUSE) or frequency data (SNPPOPUSE). (5/16/05)