GenBank often receives updates to submissions in an unusable or incorrect format. The following information provides the different methods to submit updates to GenBank
which will ensure that your update is processed quickly and correctly. Updates should be emailed directly to gb-admin@ncbi.nlm.nih.gov, or sent through
Bankit Update, or for large .sqn files through SequinMacroSend.
 Editing Source Information |
Send updates to the source information (i.e. strain, cultivar, country, specimen_voucher) in a two-column tab-delimited table, for example:
acc. num. strain
AYxxxxxx 82
AYxxxxxy ABC
|
| Nucleotide Sequence Update |
If you are updating the current nucleotide sequence send the complete new sequence(s) in fasta format:
>AYxxxxxx
cggtaataatggaccttggaccccggcaaagcggagagac
>AYxxxxxy
ggaccttgga ccccggcaaagcggagagaccggtaataat
Please do not send a list of nucleotide changes.
|
| Update features on record without annotation |
If you are adding annotation to a record that has none, then send us the features in one of the two following
formats:
[a] Spreadsheet:
accession Feature location product number gene note
EFxxxxxx CDS <1..30, 70..300 enolase homodimer
exon <1..30 1
exon 70..400 2
mRNA <1..30, 70..400 enolase
gene <1..400 ENO1
The first line of the table must be the header line. The first column must be the accession number; the second
column must be the Feature type (e.g. CDS); and the third column must be the nucleotide location of the feature.
After the first three columns, feature qualifiers may be listed in any order.
[b] Tab-delimited 5-column Feature table.
For example:
>Feature gb|EFxxxxxx|EFxxxxxx
<1 400 gene
gene ENO1
<1 30 CDS
70 300
product enolase
note homodimer
<1 30 mRNA
70 400
product enolase
<1 30 exon
number 1
70 400 exon
number 2
Please send your request to gb-admin@ncbi.nlm.nih.gov.
|
| Update features on record with annotation |
If you are updating many features of a record, let us know, and we can
send you a tab-delimited 5-column Feature table with the current annotation for you to edit and return
to us.
Or you may send us the revised features in a spread sheet.
Please send your request to gb-admin@ncbi.nlm.nih.gov
|
| Network Aware Sequin |
You can use Network aware Sequin to download your existing
record from Entrez and make the necessary changes to that file.
Mail the .sqn
file containing the updated version to: gb-admin@ncbi.nlm.nih.gov or submit to us
via Bankit Update or SequinMacroSend.
|
| Submitting publication and other general information as text |
Please send the revised/new information with the relevant GenBank Accession Numbers to us. You can use
BankitUpdate or you can include the information in the text portion of an email or as an attached word
document and send it to us at gb-admin@ncbi.nlm.nih.gov.
|
Disclaimer
Privacy statement
Revised May 25, 2007
|
